> For the complete documentation index, see [llms.txt](https://stereotoolss-organization.gitbook.io/saw-user-manual-v8.2/llms.txt). Markdown versions of documentation pages are available by appending `.md` to page URLs; this page is available as [Markdown](https://stereotoolss-organization.gitbook.io/saw-user-manual-v8.2/analysis/outputs/bam.md).

# BAM

A BAM file is in binary format for saving sequence alignment and gene annotation data. `SAW count` BAM adds custom tags in the BAM optional field to record read coordinates, CID and MID information. Annotation information is added to BAM in the tag field.&#x20;

## Tags

Custom tags are described in BAM custom tags.

<table><thead><tr><th width="141">Tag</th><th>Description</th></tr></thead><tbody><tr><td>Cx:i</td><td>x coordinate of the Coordiante ID.</td></tr><tr><td>Cy:i</td><td>y coordinate of the Coordiante ID.</td></tr><tr><td>UR:Z</td><td>The hexadecimal representation of uncorrected binary-encoded MID.</td></tr><tr><td>XF:i</td><td>Mapping region on the reference genome. Valid value: 0=EXONIC, 1=INTRONIC, 2=INTERGENIC, 3=rRNA, 4=ANTISENSE.</td></tr><tr><td>GI:Z</td><td>Annotated gene ID.</td></tr><tr><td>GE:Z</td><td>Annotated gene name.</td></tr><tr><td>GS:Z</td><td>‘+’ or ‘-’, indicating forward/reverse strand respectively.</td></tr><tr><td>UB:Z</td><td>The hexadecimal representation of count corrected binary-encoded MID.</td></tr></tbody></table>

Example of the raw BAM:

```sh
E100026571L1C009R00301275185    16      1       3000095 255     26M121066N74M   *       0       0       GGCTTTTTTTTTTTTTTTTTTTTTTTTTTTCTAAATATTGGGTTTTATTAGCACCATGATAACTGTATATTAATTTGCACTGACTGTCATAACAAAATAC      G+:GFFGGFGFFGFFGFGGFFGFFFFFCFGFCFGGGFGGFGFFFFGGFGGFGFFFGGFFGFFFGFGFGFFGFFGFGFFFFGFFFFFFFFGGFFGGFFGEF    NH:i:1  HI:i:1    AS:i:88 nM:i:0  Cx:i:4826       Cy:i:11598      UR:Z:6FA29
```

Example of the annotated BAM:

```sh
E100026571L1C002R00703943265    1040    1       3082766 255     11M132671N89M   *       0       0       CTGCTGCAGCTTTTTTTTCTTTGAGATTTATTTTTATGCTATGTGTATGGGTATTTTGCCTGCATATATGTCTATGCACCATGTGTGTGCAGTGCTTGAG    FFFFFECGFDCFGDGDFEE@EEGIBFGGCGFFGACGFCGFFDGDGFFFFFFEGCDFCGFFGG@FFF=EFFDGGGGGFDGFFFGGGFGFFGGGFFGGGDFG    NH:i:1  HI:i:1  AS:i:88 nM:i:0  Cx:i:7767       Cy:i:18052      UR:Z:7AE49      XF:i:0  GI:Z:ENSMUSG00000051951 GE:Z:Xkr4       GS:Z:-  UB:Z:79E49
```

## Statistics for transcriptome alignment

After alignment of FASTQ reads, a statistic file, recording details and output information will be saved in `/STEREO_ANALYSIS_WORKFLOW/ALIGNMENT/<lane>.CIDMap.stat`.

<table><thead><tr><th width="298">Metric</th><th>Description</th></tr></thead><tbody><tr><td>Number of CID in chip mask</td><td>Number of CIDs in the chip mask file.</td></tr><tr><td>Number of unique CID in FASTQ</td><td>Number of unique CIDs in FASTQs.</td></tr><tr><td>Number of total reads</td><td>Number of total reads in FASTQs.</td></tr><tr><td>Q10 in CID %</td><td>Ratio of Q10 CID bases.</td></tr><tr><td>Q20 in CID %</td><td>Ratio of Q20 CID bases.</td></tr><tr><td>Q30 in CID %</td><td>Ratio of Q30 CID bases.</td></tr><tr><td>Number of mapped CID</td><td>Number of reads mapped to CID.</td></tr><tr><td>% of mapped CID</td><td>Ratio of reads mapped to CID.</td></tr><tr><td>Number of exactly mapped CID</td><td>Number of reads exactly mapped to CID.</td></tr><tr><td>% of exactly mapped CID</td><td>Ratio of reads exactly mapped to CID.</td></tr><tr><td>Number of CID with mismatch</td><td>Number of reads mapped to CID with mismatch.</td></tr><tr><td>% of CID with mismatch</td><td>Ratio of reads mapped to CID with mismatch.</td></tr><tr><td>Q10 in RNA %</td><td>Ratio of Q10 RNA bases.</td></tr><tr><td>Q20 in RNA %</td><td>Ratio of Q20 RNA bases.</td></tr><tr><td>Q30 in RNA %</td><td>Ratio of Q30 RNA bases.</td></tr><tr><td>Number of reads with polyA</td><td>Number of reads with polyA sequence.</td></tr><tr><td>% of reads with polyA</td><td>Ratio of reads with polyA sequence.</td></tr><tr><td>Number of short reads (trim polyA)</td><td>Number ot short reads after trimming polyA sequence.</td></tr><tr><td>% of short reads (trim polyA)</td><td>Ration ot short reads after trimming polyA sequence.</td></tr><tr><td>Number of reads with adapter</td><td>Number of reads with adapter sequence.</td></tr><tr><td>% of reads with adapter</td><td>Ration of reads with adapter sequence.</td></tr><tr><td>Number of short reads (trim adapter)</td><td>Number of short reads after trimming adapter sequence.</td></tr><tr><td>% of short reads (trim adapter)</td><td>Ratio of short reads after trimming adapter sequence.</td></tr><tr><td>Number of reads filtered with DNB</td><td>Number of reads with DNB sequence.</td></tr><tr><td>% of reads filtered with DNB</td><td>Ratio of reads with DNB sequence.</td></tr><tr><td>Q10 in clean RNA %</td><td>Ratio of Q10 RNA bases after filtering.</td></tr><tr><td>Q20 in clean RNA %</td><td>Ratio of Q20 RNA bases after filtering.</td></tr><tr><td>Q30 in clean RNA %</td><td>Ratio of Q30 RNA bases after filtering.</td></tr><tr><td>Q10 in MID %</td><td>Ratio of Q10 MID bases.</td></tr><tr><td>Q20 in MID %</td><td>Ratio of Q20 MID bases.</td></tr><tr><td>Q30 in MID %</td><td>Ratio of Q30 MID bases.</td></tr><tr><td>Number of low quality MID</td><td>Number of MID with low quality bases.</td></tr><tr><td>% of low quality MID</td><td>Ratio of MID with low quality bases.</td></tr><tr><td>Number of MID with N</td><td>Number of MID with N base.</td></tr><tr><td>% of MID with N</td><td>Ratio of MID with N base.</td></tr><tr><td>Number of MID in specific sequence</td><td>Number of MID mapped to specific sequences.</td></tr><tr><td>% of MID with specific sequence</td><td>Ratio of MID mapped to specific sequences.</td></tr><tr><td>Q10 in clean MID %</td><td>Ratio of Q10 MID bases after filtering.</td></tr><tr><td>Q20 in clean MID %</td><td>Ratio of Q20 MID bases after filtering.</td></tr><tr><td>Q30 in clean MID %</td><td>Ratio of Q30 MID bases after filtering.</td></tr><tr><td>Number of exactly mapped MID</td><td>Number of reads exactly mapped to MID.</td></tr><tr><td>% of exactly mapped MID</td><td>Ratio of reads exactly mapped to MID.</td></tr><tr><td>Number of inexactly mapped MID</td><td>Number of reads inexactly mapped to MID.</td></tr><tr><td>% of inexactly mapped MID</td><td>Ratio of reads inexactly mapped to MID.</td></tr></tbody></table>

## Statistics for annotation

After annotation of reads, a statistic file, recording details and output information, will be saved in `/STEREO_ANALYSIS_WORKFLOW/ANNOTATION/*.bam.summary.stat`.

<table><thead><tr><th width="302">Metric</th><th>Description</th></tr></thead><tbody><tr><td>Number of input reads for annotation</td><td>Number for total reads aligned to genome.</td></tr><tr><td>Number of reads to be annotated</td><td>Number of reads that will be annotated with GTF/GFF annotation database.</td></tr><tr><td>% of reads to be annotated</td><td>% of reads that will be annotated with GTF/GFF annotation database.</td></tr><tr><td>Number of uniquely mapped reads to be annotated</td><td>Number of reads to be annotated which are uniquely mapped to genome.</td></tr><tr><td>% of uniquely mapped reads to be annotated</td><td>Ratio of reads to be annotated which are uniquely mapped to genome.</td></tr><tr><td>Number of multi-mapped reads to be annotated</td><td>Number of reads to be annotated which are multi-mapped to genome.</td></tr><tr><td>% of multi-mapped reads to be annotated</td><td>Ratio of reads to be annotated which are multi-mapped to genome.</td></tr><tr><td>Number of multi-mapped reads</td><td>Number of reads multi-mapped to genome.</td></tr><tr><td>Number of reads mapped to transcriptome</td><td>Number of reads mapped to transcriptome, including exon and intron regions.</td></tr><tr><td>% of reads mapped to transcriptome</td><td>% of reads mapped to transcriptome, including exonic and intronic regions.</td></tr><tr><td>Number of unique captures (on CID, gene and MID)</td><td>Number of unique captures for reads, based on CID, gene and MID information.</td></tr><tr><td>% of unique captures (on CID, gene and MID)</td><td>% of unique captures for reads, based on CID, gene and MID information.</td></tr><tr><td>Number of duplicated reads</td><td>Number of duplicated captures for reads, based on CID, gene and MID information.</td></tr><tr><td>% of duplicated reads</td><td>% of duplicated captures for reads, based on CID, gene and MID information.</td></tr><tr><td>Number of reads to be annotated</td><td>Number of reads that will be annotated with GTF/GFF annotation database.</td></tr><tr><td>Number of reads mapped to exonic regions</td><td>Number of reads mapped to exonic regions.</td></tr><tr><td>% of reads mapped to exonic regions</td><td>% of reads mapped to exonic regions.</td></tr><tr><td>Number of reads mapped to intronic regions</td><td>Number of reads mapped to intronic regions.</td></tr><tr><td>% of reads mapped to intronic regions</td><td>% of reads mapped to intronic regions.</td></tr><tr><td>Number of reads mapped to intergenic regions</td><td>Number of reads mapped to intergenic regions.</td></tr><tr><td>% of reads mapped to intergenic regions</td><td>% of reads mapped to intergenic regions.</td></tr><tr><td>Number of reads mapped antisense to gene</td><td>Number of reads mapped antisense to gene.</td></tr><tr><td>% of reads mapped antisense to gene</td><td>% of reads mapped antisense to gene.</td></tr><tr><td>Number of reads mapped to rRNA</td><td>Number of reads mapped to rRNA regions.</td></tr><tr><td>Number of rRNA reads in uniquely mapped</td><td>Number of uniquely mapped reads mapped to rRNA regions.</td></tr><tr><td>% of rRNA reads in uniquely mapped</td><td>% of uniquely mapped reads mapped to rRNA regions.</td></tr><tr><td>Number of rRNA reads in multi-mapped</td><td>Number of multi-mapped reads mapped to rRNA regions.</td></tr><tr><td>% of rRNA reads in multi-mapped reads</td><td>% of multi-mapped reads mapped to rRNA regions.</td></tr></tbody></table>

## Protein alignment statistics

After alignment of ADT FASTQ reads, a statistic file, recording details and output information will be saved in `/STEREO_ANALYSIS_WORKFLOW/ALIGNMENT/<SN>_map.stat`.

<table><thead><tr><th width="298">Metric</th><th>Description</th></tr></thead><tbody><tr><td>Number of CID in chip mask</td><td>Number of CIDs in the chip mask file.</td></tr><tr><td>Number of unique CID in FASTQ</td><td>Number of unique CIDs in FASTQs.</td></tr><tr><td>Number of total reads</td><td>Number of total reads in FASTQs.</td></tr><tr><td>Q10 in CID %</td><td>Ratio of Q10 CID bases.</td></tr><tr><td>Q20 in CID %</td><td>Ratio of Q20 CID bases.</td></tr><tr><td>Q30 in CID %</td><td>Ratio of Q30 CID bases.</td></tr><tr><td>Number of mapped CID</td><td>Number of reads mapped to CID.</td></tr><tr><td>% of mapped CID</td><td>Ratio of reads mapped to CID.</td></tr><tr><td>Number of exactly mapped CID</td><td>Number of reads exactly mapped to CID.</td></tr><tr><td>% of exactly mapped CID</td><td>Ratio of reads exactly mapped to CID.</td></tr><tr><td>Number of CID with mismatch</td><td>Number of reads mapped to CID with mismatch.</td></tr><tr><td>% of CID with mismatch</td><td>Ratio of reads mapped to CID with mismatch.</td></tr><tr><td>Number of CID with N</td><td>Number of CID with N base.</td></tr><tr><td>% of CID with N</td><td>Ratio of CID with N base.</td></tr><tr><td>Q10 in MID %</td><td>Ratio of Q10 MID bases.</td></tr><tr><td>Q20 in MID %</td><td>Ratio of Q20 MID bases.</td></tr><tr><td>Q30 in MID %</td><td>Ratio of Q30 MID bases.</td></tr><tr><td>Number of discarded MID</td><td>Number of discarded MID.</td></tr><tr><td>% of discarded MID</td><td>Ratio of discarded MID.</td></tr><tr><td>Number of MID with N</td><td>Number of MID with N base.</td></tr><tr><td>% of MID with N</td><td>Ratio of MID with N base.</td></tr><tr><td>Number of low quality MID</td><td>Number of MID with low quality bases.</td></tr><tr><td>% of low quality MID</td><td>Ratio of MID with low quality bases.</td></tr><tr><td>Q10 in PID %</td><td>Ratio of Q10 PID bases.</td></tr><tr><td>Q20 in PID %</td><td>Ratio of Q20 PID bases.</td></tr><tr><td>Q30 in PID %</td><td>Ratio of Q30 PID bases.</td></tr><tr><td>Number of mapped PID</td><td>Number of reads mapped to PID.</td></tr><tr><td>% of mapped PID</td><td>Ratio of reads mapped to PID.</td></tr><tr><td>Number of exactly mapped PID</td><td>Number of reads exactly mapped to PID.</td></tr><tr><td>% of exactly mapped PID</td><td>Ratio of reads exactly mapped to PID.</td></tr><tr><td>Number of PID with mismatch</td><td>Number of reads mapped to PID with mismatch.</td></tr><tr><td>% of PID with mismatch</td><td>Ratio of reads mapped to PID with mismatch.</td></tr><tr><td>Number of uniquely mapped PID</td><td>Number of reads mapped to PID uniquely.</td></tr><tr><td>% of uniquely mapped PID</td><td>Ratio of reads mapped to PID uniquely.</td></tr><tr><td>Duplication rate %</td><td>Duplication rate of the reads mapped to PID.</td></tr></tbody></table>


---

# Agent Instructions
This documentation is published with GitBook. GitBook is the documentation platform designed so that both humans and AI agents can read, navigate, and reason over technical content effectively. Learn more at gitbook.com.

## Querying This Documentation
If you need additional information that is not directly available in this page, you can query the documentation dynamically by asking a question.

Perform an HTTP GET request on the current page URL with the `ask` query parameter, and the optional `goal` query parameter:

```
GET https://stereotoolss-organization.gitbook.io/saw-user-manual-v8.2/analysis/outputs/bam.md?ask=<question>&goal=<endgoal>
```

`ask` is the immediate question: it should be specific, self-contained, and written in natural language.
`goal` is optional and describes the broader end goal you are ultimately trying to accomplish on behalf of the user. GitBook uses it to tailor the answer towards what is most useful for that goal.

The response will contain a direct answer to the question and relevant excerpts and sources from the documentation.

Use this mechanism when the answer is not explicitly present in the current page, you need clarification or additional context, or you want to retrieve related documentation sections.
