BAM

A BAM file is in binary format for saving sequence alignment and gene annotation data. SAW count BAM adds custom tags in the BAM optional field to record read coordinates, CID and MID information. Annotation information is added to BAM in the tag field.

Tags

Custom tags are described in BAM custom tags.

Tag	Description
Cx:i	x coordinate of the Coordiante ID.
Cy:i	y coordinate of the Coordiante ID.
UR:Z	The hexadecimal representation of uncorrected binary-encoded MID.
XF:i	Mapping region on the reference genome. Valid value: 0=EXONIC, 1=INTRONIC, 2=INTERGENIC, 3=rRNA.
GI:Z	Annotated gene ID.
GE:Z	Annotated gene name.
GS:Z	‘+’ or ‘-’, indicating forward/reverse strand respectively.
UB:Z	The hexadecimal representation of count corrected binary-encoded MID.

Example of the raw BAM:

E100026571L1C009R00301275185    16      1       3000095 255     26M121066N74M   *       0       0       GGCTTTTTTTTTTTTTTTTTTTTTTTTTTTCTAAATATTGGGTTTTATTAGCACCATGATAACTGTATATTAATTTGCACTGACTGTCATAACAAAATAC      G+:GFFGGFGFFGFFGFGGFFGFFFFFCFGFCFGGGFGGFGFFFFGGFGGFGFFFGGFFGFFFGFGFGFFGFFGFGFFFFGFFFFFFFFGGFFGGFFGEF    NH:i:1  HI:i:1    AS:i:88 nM:i:0  Cx:i:4826       Cy:i:11598      UR:Z:6FA29

Example of the annotated BAM:

E100026571L1C002R00703943265    1040    1       3082766 255     11M132671N89M   *       0       0       CTGCTGCAGCTTTTTTTTCTTTGAGATTTATTTTTATGCTATGTGTATGGGTATTTTGCCTGCATATATGTCTATGCACCATGTGTGTGCAGTGCTTGAG    FFFFFECGFDCFGDGDFEE@EEGIBFGGCGFFGACGFCGFFDGDGFFFFFFEGCDFCGFFGG@FFF=EFFDGGGGGFDGFFFGGGFGFFGGGFFGGGDFG    NH:i:1  HI:i:1  AS:i:88 nM:i:0  Cx:i:7767       Cy:i:18052      UR:Z:7AE49      XF:i:0  GI:Z:ENSMUSG00000051951 GE:Z:Xkr4       GS:Z:-  UB:Z:79E49

Statistics for alignment

After alignment of FASTQ reads, a statistic file, recording details and output information will be saved in /STEREO_ANALYSIS_WORKFLOW/ALIGNMENT/<lane>.CIDMap.stat.

Metric	Description
Number of CID in chip mask	Number of CIDs in the chip mask file
Number of unique CID in FASTQ	Number of unique CIDs in FASTQs
Number of total reads	Number of total reads in FASTQs
Q10 in CID %	Ratio of Q10 CID bases
Q20 in CID %	Ratio of Q20 CID bases
Q30 in CID %	Ratio of Q30 CID bases
Number of mapped CID	Number of reads mapped to CID
% of mapped CID	Ratio of reads mapped to CID
Number of exactly mapped CID	Number of reads exactly mapped to CID
% of exactly mapped CID	Ratio of reads exactly mapped to CID
Number of CID with mismatch	Number of reads mapped to CID with mismatch
% of CID with mismatch	Ratio of reads mapped to CID with mismatch
Q10 in RNA %	Ratio of Q10 RNA bases
Q20 in RNA %	Ratio of Q20 RNA bases
Q30 in RNA %	Ratio of Q30 RNA bases
Number of reads with polyA	Number of reads with polyA sequence
% of reads with polyA	Ratio of reads with polyA sequence
Number of short reads (trim polyA)	Number ot short reads after trimming polyA sequence
% of short reads (trim polyA)	Ration ot short reads after trimming polyA sequence
Number of reads with adapter	Number of reads with adapter sequence
% of reads with adapter	Ration of reads with adapter sequence
Number of short reads (trim adapter)	Number of short reads after trimming adapter sequence
% of short reads (trim adapter)	Ratio of short reads after trimming adapter sequence
Number of reads filtered with DNB	Number of reads with DNB sequence
% of reads filtered with DNB	Ratio of reads with DNB sequence
Q10 in clean RNA %	Ratio of Q10 RNA bases after filtering
Q20 in clean RNA %	Ratio of Q20 RNA bases after filtering
Q30 in clean RNA %	Ratio of Q30 RNA bases after filtering
Q10 in MID %	Ratio of Q10 MID bases
Q20 in MID %	Ratio of Q20 MID bases
Q30 in MID %	Ratio of Q30 MID bases
Number of low quality MID	Number of MID with low quality bases
% of low quality MID	Ratio of MID with low quality bases
Number of MID with N	Number of MID with N base
% of MID with N	Ratio of MID with N base
Number of MID in specific sequence	Number of MID mapped to specific sequences
% of MID with specific sequence	Ratio of MID mapped to specific sequences
Q10 in clean MID %	Ratio of Q10 MID bases after filtering
Q20 in clean MID %	Ratio of Q20 MID bases after filtering
Q30 in clean MID %	Ratio of Q30 MID bases after filtering
Number of exact MID	Number of reads exactly mapped to MID
% of exact MID	Ratio of reads exactly mapped to MID
Number of inexact MID	Number of reads inexactly mapped to MID
% of inexact MID	Ratio of reads inexactly mapped to MID

Statistics for annotation

After annotation of reads, a statistic file, recording details and output information, will be saved in /STEREO_ANALYSIS_WORKFLOW/ANNOTATION/*.bam.summary.stat.

Metric	Description
Number of total reads	Number for total reads aligned to genome
Number of reads to be annotated	Number of reads that will be annotated with GTF/GFF annotation database
% of reads to be annotated	% of reads that will be annotated with GTF/GFF annotation database
Number of uniquely mapped reads to be annotated	Number of reads to be annotated which are uniquely mapped to genome
% of uniquely mapped reads to be annotated	Ratio of reads to be annotated which are uniquely mapped to genome
Number of multi-mapped reads to be annotated	Number of reads to be annotated which are multi-mapped to genome
% of multi-mapped reads to be annotated	Ratio of reads to be annotated which are multi-mapped to genome
Number of multi-mapped reads	Number of reads multi-mapped to genome
Number of reads mapped to transcriptome	Number of reads mapped to transcriptome, including exon and intron regions.
% of reads mapped to transcriptome	% of reads mapped to transcriptome, including exonic and intronic regions.
Number of unique captures (on CID, gene and MID)	Number of unique captures for reads, based on CID, gene and MID information
% of unique captures (on CID, gene and MID)	% of unique captures for reads, based on CID, gene and MID information
Number of duplicated reads	Number of duplicated captures for reads, based on CID, gene and MID information
% of duplicated reads	% of duplicated captures for reads, based on CID, gene and MID information
Number of reads to be annotated	Number of reads that will be annotated with GTF/GFF annotation database
Number of reads mapped to exonic regions	Number of reads mapped to exonic regions
% of reads mapped to exonic regions	% of reads mapped to exonic regions
Number of reads mapped to intronic regions	Number of reads mapped to intronic regions
% of reads mapped to intronic regions	% of reads mapped to intronic regions
Number of reads mapped to intergenic regions	Number of reads mapped to intergenic regions
% of reads mapped to intergenic regions	% of reads mapped to intergenic regions
Number of reads mapped antisense to gene	Number of reads mapped antisense to gene
% of reads mapped antisense to gene	% of reads mapped antisense to gene
Number of reads mapped to rRNA	Numder of reads mapped to rRNA regions
Number of rRNA reads in uniquely mapped	Numder of uniquely mapped reads mapped to rRNA regions
% of rRNA reads in uniquely mapped	% of uniquely mapped reads mapped to rRNA regions
Number of rRNA reads in multi-mapped	Numder of multi-mapped reads mapped to rRNA regions
% of rRNA reads in multi-mapped reads	% of multi-mapped reads mapped to rRNA regions